Πέμπτη, 5 Απριλίου 2018

ΑΙΣΩΠΟΣ - Μῦθοι (246.1-250.1)

246. ΚΑΜΗΛΟΣ, ΕΛΕΦΑΣ ΚΑΙ ΠΙΘΗΚΟΣ [246.1] τῶν ἀλόγων ζῴων βουλομένων βασιλέα ἑαυτῶν ἑλέσθαι κάμηλος καὶ ἐλέφας καταστάντες ἐφιλονείκουν καὶ διὰ τὸ μέγεθος τοῦ σώματος καὶ διὰ τὴν ἰσχὺν ἐλπίζοντες πάντων προκρίνεσθαι. πίθηκος δὲ ἀμφοτέρους ἀνεπιτηδείους εἶναι ἔφη, τὴν μὲν κάμηλον, διότι χολὴν οὐκ ἔχει κατὰ τῶν ἀδικούντων, τὸν δὲ ἐλέφαντα, ὅτι δέος ἐστί, μὴ αὐτοῦ βασιλεύοντος χοιρίδιον ἡμῖν ἐπιθῆται.
ὁ λόγος δηλοῖ, ὅτι πολλάκις καὶ τὰ μέγιστα τῶν πραγμάτων διὰ μικρὰν αἰτίαν κωλύονται.

247. ΚΥΚΝΟΣ
[247.1] τοὺς κύκνους φασὶ παρὰ τὸν θάνατον ᾄδειν. καὶ δή τις περιτυχὼν κύκνῳ πωλουμένῳ καὶ ἀκούσας, ὅτι εὐμελέστατόν ἐστι ζῷον, ἠγόρασε. καὶ ἔχων ποτὲ συνδείπνους προσελθὼν παρεκάλει αὐτὸν ᾆσαι ἐν τῷ πότῳ. τοῦ δὲ τότε μὲν ἡσυχάσαντος, ὕστερον δέ ποτε, ὡς ἐνόησεν, ὅτι ἀποθνῄσκειν ἔμελλεν, ἑαυτὸν θρηνοῦντος ὁ δεσπότης ἀκούσας ἔφη· «ἀλλ᾽ εἰ σὺ οὐκ ἄλλως ᾄδεις, ἐὰν μὴ ἀποθνῄσκῃς, ἐγὼ μάταιος ἤμην τότε, ὅτε σε παρεκάλουν, ἀλλ᾽ οὐκ ἔθυον».
οὕτως ἔνιοι τῶν ἀνθρώπων, ἃ μὴ ἑκόντες χαρίσασθαι βούλονται, ταῦτα ἄκοντες ἐπιτελοῦσιν.

248. ΖΕΥΣ ΚΑΙ ΟΦΙΣ
[248.1] τοῦ Διὸς γαμοῦντος πάντα τὰ ζῷα ἀνήνεγκαν δῶρα, ἕκαστον ὅτι ἐδύνατο. ὄφις δὲ ἕρπων ῥόδον ἀναλαβὼν τῷ στόματι ἀνέβη. ἰδὼν δὲ αὐτὸν ὁ Ζεὺς ἔφη· «τῶν ἄλλων πάντων τὰ δῶρα λαμβάνω· ἀπὸ δὲ τοῦ σοῦ στόματος οὐ λαμβάνω».
ὁ λόγος δηλοῖ, ὅτι τῶν πονηρῶν αἱ χάριτες φοβεραί εἰσιν.

249. ΤΑΩΝ ΚΑΙ ΓΕΡΑΝΟΣ
[249.1] ταὼν γεράνου κατεγέλα κωμῳδῶν τὴν χροίαν αὐτοῦ καὶ λέγων ὡς· «ἐγὼ μὲν χρυσὸν καὶ πορφύραν ἐνδέδυμαι, σὺ δὲ οὐδὲν καλὸν φέρεις ἐν πτεροῖς». ὁ δὲ «ἀλλ᾽ ἐγώ», ἔφη, «τῶν ἀστέρων ἔγγιστα φωνῶ καὶ εἰς τὰ οὐράνια ὕψη ἵπταμαι, σὺ δὲ ὡς ἀλέκτωρ κάτω μετ᾽ ὀρνίθων βαίνεις».
ὅτι κρεῖττον περίβλεπτον εἶναί τινα ἐν πενιχρᾷ ἐσθῆτι ἢ ζῆν ἀδόξως ἐν πλούτῳ γαυρούμενον.

250. ΥΣ ΚΑΙ ΚΥΩΝ
[250.1] ὗς καὶ κύων πρὸς ἀλλήλας διεφέροντο. τῆς δὲ ὑὸς ὀμνυούσης τὴν Ἀφροδίτην, ὅτι ἐὰν μὴ παύσηται, τοῖς ὀδοῦσιν αὐτὴν ἀνατεμεῖ, ἡ κύων ἔλεγε καὶ κατ᾽ αὐτὸ τοῦτο αὐτὴν ἀγνωμονεῖν † εἴγε Ἀφροδίτην μισεῖ, ὥστε, ἐὰν φάγῃ τις κρέα ὑός, τοῦτον οὐκ ἐᾷ εἰς τὸ ἱερὸν αὐτῆς εἰσιέναι. καὶ ἡ ὗς ὑποτυχοῦσα ἔφη· «ἀλλὰ τοῦτό γε οὐ στυγοῦσά με ποιεῖ, προνοουμένη δέ, ἵνα μηδείς με θύῃ».
οὕτως οἱ φρόνιμοι τῶν ῥητόρων πολλάκις καὶ τὰ ὑπὸ τῶν ἐχθρῶν προσφερόμενα ὀνείδη εἰς ἐπαίνους μετασχηματίζουσιν.

***
246. Η καμήλα, ο ελέφαντας και ο πίθηκος.
[246.1] Μια φορά και έναν καιρό τα άλογα ζώα αποφάσισαν να εκλέξουν κάποιον από ανάμεσά τους για βασιλιά. Έτσι που λέτε, η καμήλα και ο ελέφαντας, που αναγνωρίστηκαν ως οι επικρατέστεροι υποψήφιοι, άρχισαν να ερίζουν μεταξύ τους. Καθένας τους ήλπιζε, βλέπετε, πως θα τον προτιμούσαν έναντι όλων των άλλων, τόσο για τον όγκο του σώματός του όσο και για τη δύναμή του. Εκεί πάνω, όμως, παρενέβη ο πίθηκος και δήλωσε ότι και οι δυο τους ήσαν ακατάλληλοι για το αξίωμα, για τους εξής λόγους: Η καμήλα, αφενός, επειδή δεν έχει στάλα χολή μέσα της για να θυμώσει ενάντια στην αδικία· και ο ελέφαντας, αφετέρου, επειδή υπάρχει κίνδυνος να μας επιτεθούν τα γουρουνάκια όσο θα βασιλεύει.
Το δίδαγμα του μύθου: Πολύ συχνά ακόμη και τα πιο σπουδαία επιτεύγματα παρεμποδίζονται από μικροπράγματα.

247. Ο κύκνος.
[247.1] Καθώς λέγεται, οι κύκνοι τραγουδούν όταν φτάνει η ώρα του θανάτου τους. Μια φορά, που λέτε, κάποιος είδε κατά τύχη να πουλάνε έναν κύκνο στο παζάρι. Είχε ακούσει κιόλας ότι τούτο το πλάσμα είναι εξαιρετικά μελωδικό, γι᾽ αυτό και τον αγόρασε. Έτσι λοιπόν, κάποια βραδιά που έκανε το τραπέζι στους καλεσμένους του, ο ανθρωπάκος μας έφερε μέσα τον κύκνο του και τον πρόσταξε να τραγουδήσει κατά το συμπόσιο. Ωστόσο το πουλί δεν εννοούσε να βγάλει κιχ εκείνη την ώρα. Μόνο αργότερα, όταν κατάλαβε ότι τον περίμενε ο θάνατος, ξέσπασε σε μοιρολόι για τον εαυτό του. Ακούγοντάς τον τότε, ο αφέντης του παρατήρησε: «Α έτσι μου είσαι, λοιπόν! Δεν τραγουδάει ο κύριος από εδώ, παρά μόνο όταν περιμένει να πεθάνει. Μωρέ, χαζομάρα έκανα τότε που σου έδωσα εντολή να τραγουδήσεις. Έπρεπε μάλλον να έδινα διαταγές να σε σφάξουν».
Έτσι συμβαίνει με μερικούς ανθρώπους: Όσα δεν εννοούν να τα κάνουν με το καλό, σαν χάρη, τα εκτελούν με το ζόρι.

248. Ο Δίας και το φίδι.
[248.1] Τον καιρό εκείνο τον παλιό, όταν γιόρταζε ο Δίας τους γάμους του, όλα τα ζώα τού έφεραν δώρα, ό,τι μπορούσε το καθένα. Ανάμεσά τους, που λέτε, σύρθηκε σιγά-σιγά μέχρι εκεί ψηλά και το φίδι, κουβαλώντας ένα τριαντάφυλλο που είχε πιάσει με το στόμα του. Μόλις όμως το είδε ο Δίας, αντέδρασε: «Κοίταξε να δεις, όλων των άλλων τα δώρα τα δέχομαι. Από το στόμα το δικό σου, όμως, δεν θέλω ούτε χάρισμα να λάβω».
Το δίδαγμα του μύθου: Ακόμη και τη χάρη που σου κάνει ο αχρείος, πρέπει να τη φοβάσαι.

249. Το παγόνι και ο γερανός.
[249.1] Μια φορά το παγόνι περιγελούσε τον γερανό, κοροϊδεύοντας ιδίως το χρώμα του. Νά τί του έλεγε: «Δεν με βλέπεις εμένα που είμαι ντυμένο στο χρυσάφι και στην πορφύρα; Ενώ εσύ κακομοίρη, εσύ δεν έχεις ίχνος ομορφιάς στα φτερά σου». Όμως ο γερανός αποκρίθηκε: «Ξεχνάς κάτι, χρυσό μου. Εγώ μπορώ και πετάω στα ύψη του ουρανού και συνομιλώ από κοντά με τα αστέρια. Ενώ εσύ, καημενούλικο, πορεύεσαι κάτω στη γη σαν τον κόκορα, αντάμα με τις κοτούλες».
Δίδαγμα: Κάλλιο να απολαμβάνεις τον θαυμασμό του κόσμου, έστω και ντυμένος φτωχικά, παρά να περνάς τη ζωή σου άδοξα και να καυχιέσαι μόνο για τα πλούτη σου.

250. Η γουρούνα και η σκύλα.
[250.1] Μια φορά τσακώνονταν μεταξύ τους η γουρούνα και η σκύλα. Η πρώτη, που λέτε, πήρε όρκο στην Αφροδίτη ότι θα ξεσκίσει τη σκύλα με τα δόντια της, αν τούτη η τελευταία δεν βγάλει τον σκασμό. Τότε η αντίπαλός της σάρκασε: «Μωρή, και μόνο με αυτό που είπες δείχνεις την παχυλή άγνοιά σου. Δεν έχεις καταλάβει, βρε, ότι η Αφροδίτη σε σιχαίνεται; Απόδειξη: άμα κανείς φάει χοιρινό κρέας, δεν του επιτρέπει καν να μπει στον ναό της». Όμως η γουρούνα δεν πτοήθηκε καθόλου, παρά αντιγύρισε: «Τόσα ξέρεις, τόσα λες, μωρή. Δεν το κάνει αυτό από μίσος για μένα. Απεναντίας, έτσι ακριβώς δείχνει τη φροντίδα της για χάρη μου, ώστε να μη με σφάξει κανείς».
Έτσι κάνουν και οι πιο επιτήδειοι ρήτορες: Πολύ συχνά καταφέρνουν να μεταστρέφουν σε επαίνους τις προσβολές που τους απευθύνουν οι αντίπαλοί τους.

Θρησκευτικός συγκρητισμός: Ο θάνατος και η ανάσταση των θεών

Σχετική εικόνα«Οι Φρύγες, επίσης, που πίστευαν ότι ο Θεός κοιμάται τον χειμώνα, ενώ το καλοκαίρι είναι ξυπνητός» Πλούταρχος, Ηθικά

Ο πρωτόγονος άνθρωπος βρέθηκε μπροστά σε δυο πραγματικότητες απέναντι στις οποίες ένιωσε αδύναμος βιολογικά. Αυτές ήταν το φυσικό περιβάλλον και ο Θάνατος. Ως προς το φυσικό περιβάλλον ένιωσε άμεσα εξαρτημένος, αφού αυτό αποτελούσε (εί) πηγή της βιολογικής του συντήρησης και επιβίωσης. Απέναντι στις φυσικές δυνάμεις (βροχή, σεισμός, εναλλαγή εποχών κλπ) ήταν άοπλος και εκτεθειμένος στη μη προβλεψιμότητά τους.

Ο θάνατος για τον πρωτόγονο στο βαθμό που ταυτίστηκε με τη βιολογική περατότητά του συνιστούσε τον απόλυτο φόβο και απέκτησε ένα μυστηριακό χαρακτήρα που ακόμη και σήμερα η επιστήμη – φιλοσοφία δεν απάντησε στο ερώτημα «γιατί πεθαίνουμε».

Έτσι τις δυο αυτές πραγματικότητες (φυσικό περιβάλλον – θάνατος) σε μια ύστερη φάση τις αναγνώρισε ως νομοτέλεια και αναγκαιότητα. Ωστόσο αυτή η αναγνώριση δεν σήμανε και μια τυφλή παραίτηση ή αποδοχή αλλά το πρώτο βήμα για να τις ερμηνεύσει και να τις υπερβεί. Απώτατος στόχος να νιώσει ελεύθερος και ασφαλής «Ελευθερία είναι η αποδοχή της αναγκαιότητας». Έγελος

Όσο κι αν η θέση του Hegel συνιστά οξύμωρο σχήμα δεν παύει να υποδηλώνει την αγωνία του ανθρώπου να επιβιώσει (βιολογικά – πνευματικά – ηθικά) μέσα από τις επιταγές μιας αδήριτης αναγκαιότητας. Προς το σκοπό αυτό θεοποίησε τις φυσικές δυνάμεις ως μια μορφή άμυνας απέναντι στη «δύναμή» τους.

Ο Ουρανός και η Γαία (γη) αποτέλεσαν το πρώτο δίδυμο των θεών. Έκτοτε ακολούθησαν κι άλλες θεοποιήσεις σε μια προσπάθεια να κατανοήσει την αναγκαιότητα της δύναμης της φύσης και να συμφιλιωθεί μαζί της. Κι αυτό γιατί αυτή για τον άνθρωπο ήταν ο μέγιστος «χορηγός» και «διδάσκαλος». Η δικαιοσύνη, το μέτρο, η κοσμιότητα και η αρμονία αποτελούσαν τα βασικά στοιχεία της ύπαρξής της.

Έτσι η φύση δεν άργησε να αποτελέσει αντικείμενο λατρείας μέσα από τη δημιουργία της θρησκείας και των διαφόρων θεοτήτων που αντιπροσώπευαν βασικές εκφράσεις του φυσικού περιβάλλοντος αλλά και των ανθρώπινων αναγκών. Η Δήμητρα, η Άρτεμις, ο Διόνυσος, οι Νύμφες, οι Ναϊάδες, οι Ορεστιάδες, οι Δρυάδες και οι Νηρηίδες αποτελούσαν αντικείμενο λατρείας και θεοποίησης. Όλες αυτές οι θεότητες δεν ήταν κάτι απόκοσμο αλλά στοιχείο της καθημερινότητας των ανθρώπων.

Έτσι μέσα από τη θεοποίηση των φυσικών δυνάμεων ο άνθρωπος συμφιλιώθηκε και με την ιδέα του θανάτου προσδίδοντας στους ανθρωπόμορφους θεούς του το στοιχείο της αθανασίας. Οι θεοί πάσχουν, υποφέρουν, πονούν αλλά δεν πεθαίνουν. Κι αν αυτό συμβεί, είναι προσωρινό γιατί πάντα ακολουθεί η ανάστασή τους. Επομένως το σχήμα Ζωή – Θάνατος – Ανάσταση είναι κοινός τόπος όχι μόνο της Ελληνικής μυθολογίας – θρησκείας αλλά και πολλών άλλων θρησκειών.

Αυτό καταδεικνύει πως τα δυο κομβικά στοιχεία του χριστιανισμού η Σταύρωση και η Ανάσταση έλκουν την καταγωγή τους τόσο από την αρχαία μυθολογία αλλά κι από τους μύθους – θρησκείες άλλων λαών, με τις αναγκαίες κάθε φορά παραλλαγές. Ωστόσο το βασικό μοτίβο – σχήμα ο Θάνατος – η Ανάσταση του θεού παραμένει ως μια εκδήλωση της ανθρώπινης – διαχρονικής και επίμονης – επιθυμίας αλλά και αγωνίας του ανθρώπου να συγκρουστεί με το παράλογο «absurdum» του θανάτου και της ανάστασης.

Εξάλλου ο πρωτόγονος – αλλά και ο σύγχρονος – άνθρωπος αυτό που βιώνει εκατομμύρια χρόνια είναι ο κύκλος της φυσικής λειτουργίας μέσα από τις εποχές και κυρίως το χειμώνα και το καλοκαίρι (η ακαρπία – η φθορά vs βλάστηση – ευφορία – αναγέννηση της φύσης). Δίπλα σε αυτά το Πένθος και η Χαρά κυριαρχούν ως ανθρώπινα συναισθήματα και συγκροτούν το πλαίσιο ζωής του θνητού ανθρώπου.

Η αλλαγή, λοιπόν, των εποχών, η γονιμότητα και η ακαρπία, η βλάστηση και η «ύπνωση» της φύσης υφαίνουν τον ιστό πολλών μύθων και θρησκευτικών δοξασιών ή λατρειών σε παγκόσμιο επίπεδο. Εξάλλου, γρήγορα οι άνθρωποι συνειδητοποίησαν πως ο κυκλικός χρόνος (γέννηση – θάνατος – αναγέννηση) συνιστά το θεμέλιο της κοσμικής τάξης. Αυτή η κοσμική τάξη αποτέλεσε το βάθρο πάνω στο οποίο η ανθρωπότητα οικοδόμησε το ηθικό και κοινωνικοπολιτικό σύστημα αλλά και τις προοπτικές για μια ζωή με πνευματικότητα και συναισθηματική πληρότητα.

«Αυτό που σήμερα αποκαλείται Χριστιανική θρησκεία, υπήρχε ήδη ανάμεσα στους αρχαίους και δεν έλειπε και στις απαρχές της ανθρώπινης φυλής. Όταν ο Χριστός εμφανίστηκε ένσαρκος, η αληθινή θρησκεία, που ήδη υπήρχε, έλαβε την ονομασία Χριστιανική». Άγιος Αυγουστίνος

Κρίνεται αναγκαία η αναφορά σε εκείνες τις θεϊκές οντότητες που γεννήθηκαν ως θνητές, υπέφεραν, πέθαναν και αναστήθηκαν. Το πρότυπο του Θεού που πεθαίνει και ανασταίνεται επαναλαμβάνεται διαρκώς σε διαφορετικά πολιτισμικά και θρησκευτικά περιβάλλοντα.

Παρόλες τις διαφορές οι αρχαίες παγανιστικές θρησκείες και ο χριστιανισμός μοιράζονται πολλά κοινά στοιχεία. Ο θρησκευτικός συγκρητισμός αποτέλεσε μια πραγματικότητα ενισχύοντας ή και διευκολύνοντας τις πνευματικές – πολιτιστικές προσαρμογές «με την ποικίλη δράση των στοχαστικών προσαρμογών» Κ. Καβάφης 

Μπορεί η «Ανάσταση του Ιησού» να συνιστά την απόλυτη απόδειξη για τη θεϊκή φύση του Χριστού, ωστόσο η ιστορική αλήθεια έχει τις ρίζες της και σε άλλες αρχαίες θρησκείες που πίστευαν σε θεούς που πέθαιναν και ανασταίνονταν. Δεν είναι, λοιπόν, μόνο ο Χριστιανισμός που θεμελιώνει την πίστη πάνω στην Ανάσταση «Ει δε Χριστός ουκ εγήγερται, ματαία η πίστις υμών» (Απόστολος Παύλος, Επιστολή Α προς Κορινθίους, ιε, 17), αλλά και πολλές άλλες θρησκείες περιλαμβάνουν στις λατρευτικές τους εκδηλώσεις το στοιχείο της Ανάστασης.

Μια αδρομερής καταγραφή του μοντέλου «ο θάνατος και η ανάσταση του θεού» θα ήταν ωφέλιμη για την κατανόηση του θρησκευτικού συγκρητισμού και τη γονιμοποιό δύναμή του στην αλληλοκατανόηση και ειρηνική συνύπαρξη Θρησκειών και λαών. Η λεπτομερής καταγραφή υπερβαίνει το σκοπό του παρόντος άρθρου.

Ο Άδωνις (σημιτικός θεός που έγινε αποδεκτός κι από τους Έλληνες), ο θρακικός Διόνυσος (ο επανομαζόμενος και Ζαγρεύς), ο Αιγύπτιος Όσιρις, ο Ινδός Κρίσνα, ο Μίθρα (Πέρσης θεός), ο Ταμούζ (Ασσυροβαβυλώνιος θεός), ο Άττις (Φρυγία), ο Όντιν (σκανδιναβική θεότητα), ο Κετζαλκόατλ (Κεντρική Αμερική), ο Υάκινθος, η Περσεφόνη είναι μερικά παραδείγματα που πιστοποιούν τις διάφορες παραλλαγές του αναστημένου θεού.

Εις τα καθ’ ημάς δέσποζε ο μύθος της Δήμητρας – Περσεφόνης και τα Αδώνεια, όπως βέβαια και Βακχικές τελετές ή του Διόνυσου. Ειδικότερα ο μύθος της Δήμητρας – Περσεφόνης συμβόλιζε την εναλλαγή των εποχών με ευθεία αναφορά στο φαινόμενο του σπόρου που περιμένει υπομονετικά να έρθει η άνοιξη για να αναπτυχθεί και να καρπίσει.

Οι Αδώνιες τελετές παραπέμπουν στις αντίστοιχες του Χριστιανικού Πάσχα, με την αναπαράσταση του θανάτου και της ανάστασης του Άδωνι. Η πρώτη ημέρα των «Αδώνειων μυστηρίων» λεγόταν «αφανισμός» και ήταν ημέρα πένθους για το θάνατο του θεού. Η δεύτερη μέρα λεγόταν «εύρεσις» και αντιστοιχούσε με τη δική μας Ανάσταση (ημέρα χαράς και αγαλλίασης).

Παρακολουθώντας τα δρώμενα σε θεολογικό επίπεδο διαπιστώνουμε ομοιότητες και επαναλήψεις αρχαίων Ελληνικών συμβόλων στον Χριστιανισμό. Εξάλλου οι μορφές του Προμηθέα και Χριστού βαδίζουν παράλληλα, αφού και οι δυο πάσχουν για τον άνθρωπο.

Όσα, λοιπόν, αντίκεινται στους φυσικούς νόμους, στην ανθρώπινη εμπειρία και στον επιστημονικό ορθολογισμό μπορεί να μας τρομάζουν αλλά είναι η άλλη – η αθέατη πλευρά της ανθρώπινης ύπαρξης. Είναι οι πολλαπλές εκδοχές του ανθρώπινου πνεύματος και του πολιτισμού, τον οποίο πρέπει να εξετάζουμε στην ολότητά του και στη διαχρονικότητά του. Έτσι κατανοούμε καλύτερα το παρελθόν, συνειδητοποιούμε τη θέση μας στο παρόν και αισιοδοξούμε για το μέλλον.

«Όποιος έχει στα χέρια του τον πολιτισμό, έχει στα χέρια του τον κόσμο». Καντ

Ρωτάς πράγματα που δεν απαντιούνται

Λένε, λοιπόν, πως κάποτε έγινε ένας αγώνας ανάμεσα στον Όμηρο και στον Ησίοδο για το πρωτείο. Να κριθεί, τέλος πάντων, στους Έλληνες, ποιος από τους δύο μεγαλύτερους είναι ο πιο μεγάλος.

Η επιτροπή κρίσης, εκεί κάπου στην Αυλίδα ή στις Θήβες, κάθισε με σεβασμό τους δύο σοφούς στο θρονί τους, και άρχισε να τους ερωτά. Ήθελαν να μετρήσουν, ποιος θα δώσει τις πιο φρόνιμες αποκρίσεις στα ζητήματα.

Ρωτήσανε τον Ησίοδο, και αποκρίθηκε ζυγιασμένα. Οι θέσεις που έλαβε, φανέρωναν τον άνθρωπο με την πλούσια πείρα που έζησε στον κόσμο ζωντανός. Που έκαμε, και έπαθε, και έμαθε.

Ρωτήσανε και τον Όμηρο. Ο γλυκός αοιδός με τη λευκή κεφαλή και τα άδεια μάτια, που κάποια ερμηνεία θέλει να επιμένει πως έχασε το φως του γιατί δεν άντεξε το πολύ κακό που αντίκρυσε στον κόσμο, τους άκουσε μειλίχια.

Πες μας, λοιπόν, αστέρι στις θάλασσες και ήλιε στα βουνά, του είπανε. Πες μας, ποιο το μεγαλύτερο στον άνθρωπο καλό. Άριστο σε όλους και σε όλες, αποκρίθηκε ο Όμηρος, είναι ο άνθρωπος ποτέ να μη γεννιέται!.

Η επιτροπή έμεινε καγκελόξυλο. Ένας πονηρός όμως ανάμεσα στους κριτές, ένας ελληνικά πονηρός, ένας μικρός Οδυσσέας, σκόρπισε την ταραχή που γέννησε η σπαθιά του Ομήρου με μια δεύτερη ερώτηση.

Κανένας, του λέει, δε μας ζήτησε γνώμη, αν θέλουμε να μας γεννήσει ή όχι. Να μας ειπείς, λοιπόν, ποιο είναι το δεύτερο στον άνθρωπο καλό, που να το κρατά και στο χέρι. Τό πάντων αιρετώτατον. Εκείνο που να μπορούμε δηλαδή να το διαλέγουμε κιόλας.

Το δεύτερο στον άνθρωπο καλό, είπε ο Όμηρος, είναι όταν γεννηθεί ο άνθρωπος, αμέσως να πεθαίνει.

Αυτή η απόκριση κρύβει τη βία της ανάγκης και την αλυπησιά του χάρου. Και κάνει τον Όμηρο να γίνεται ο πρώτος τιμητής του θεού, όπως ο Κάϊν είναι ο πρώτος φονιάς του ανθρώπου.

Όσο και να εξερευνά κανείς στη χώρα του θρήνου, δε θα βρει πικρότερη θέση. Όπως δεν πρόκειται να βρε γυναίκα πιο ωραία από την ωραία Ελένη, που και κείνη την έπλασε ο Όμηρος.

Ωστόσο εμείς μπορούμε να γνωρίζουμε πως πίσω από τον Όμηρο δε μιλάει ο Όμηρος, αλλά το συλλογικό πνεύμα της Ελλάδας.

Τα λόγια του είναι η δημοτική απήχηση του πνεύματος ενός λαού απάνου σε ένα ερώτημα που αγωνίζεται να κλείσει όλα του ανθρώπου τα υπάρχοντα. Είναι μια απόκριση ίδια με τη λύση που προσπαθεί να δώσει σήμερα η θεωρία του ενιαίου πεδίου, όπου μέσα σ’ ένα τύπο οι φυσικοί αγωνίζονται να κλείσουν όλους τους νόμους της φύσης.

Άλλωστε το ξέρουμε, διακοσίους χρόνους τώρα κοντά, πως ο Όμηρος δεν υπήρξε. Το αθάνατο όνομά του είναι το δημοτικό τραγούδι των παλαιών Ελλήνων.

Στα ίδια πατήματα βρίσκεται και η ιστορία που σώθηκε στα Αποσπάσματα του Αριστοτέλη, και σ’ ένα κείμενο του Πλούταρχου. Είναι μάλιστα σημαδιακό, που η ιδέα αρχίζει με τον Όμηρο, την εκκίνηση, περνάει από τον Αριστοτέλη, το τέρμα της κλασσικής Ελλάδας, και τελειώνει στον Πλούταρχο, την κατακλείδα του ελληνικού κόσμου.

Και να μη λησμονούμε ότι ο Πλούταρχος είναι μια επιβλητική μορφή στην Ελλάδα. Ρουσσώ, Γκαίτε, και Ναπολέων τον είχαν ολοζωής στο μαξιλάρι τους.

Κυνηγούσε, λέει η αφήγηση, ο βασιλιάς Μίδας αγρίμια στα όρη της Μακεδονίας. Εκεί, αποσταμένος, έγειρε στη ρίζα ενού δρυ να συνεφέρει. Τότες ήταν που είδε δίπλα του το Σιληνό να κοιμάται.

Έχω την ευκαιρία, συλλογίστηκε ο ξύπνιος βασιλιάς. Και πιάνει το δαίμονα, και τον δένει με το σκοινί, να μη φύγει. Λέει:

– Εγώ θα σ’ απολύσω, αλλά πρώτα να μου ειπείς.

-Πες το μου, να στο ειπώ, κι απέ να μ’ αφήσεις να φύγω, του λέει ο αρχισάτυρος. Κι ούτε χρειαζόταν να με δέσεις, για να σου ειπώ.

– Εξήγα μου, λοιπόν. Εσύ που κρέμεσαι ανάμεσα ουρανού και γης, και γνωρίζεις πράγματα που δεν φτάνει ανθρώπου νους. Εξήγα μου, γιατί χρόνους τώρα τυραννιέμαι, και πάω να κρεπάρω. Ποιο είναι το μεγαλύτερο στον άνθρωπο καλό;

Ο Σιληνός αλαφιάστηκε. Τον συνεπήρε το ξάφνιασμα, ιδιοτρόπησε, κοίταξε πέρα.

–Λύσε με να πηγαίνω, του λέει, και τράβα στο καλό σου. Ρωτάς πράγματα που δεν απαντιούνται.

Ο Μίδας εστάθηκε.

-Κι αν δε μου αποκριθείς, του λέει, σ’ αυτό που σ’ ερωτή, δεν έχεις λευτεριά. Εδώ στο δέντρο θα μείνεις δεντρωμένος. Όσο να σε λύσει ο λιμός, και να σε κατελύσει ο λύκος.

Θύμωσε τότε ο δαίμονας. Τίναξε βίαια τα χέρια του ψηλά, πέσανε τα δεσμά. Έστρεψε και κοίταξε τον άνθρωπο βλοσυρά, κι όλα γύρω του μυρίσανε θειάφι. Το θείο συνέπηρε τον τόπο. Ο Μίδας, του πάρθηκε η μιλιά, κι έπεσε κατά γης. Και τότε ο Σιληνός, ο κορυφαίος στα όργια και ο σύντροφος του Διονύσου, τον επιτίμησε:

-Δαίμονος επιμόνου και τύχης χαλεπής εφήμερον σπέρμα, τι με βιάζεσθε λέγειν, ά υμίν άρειον μη γνωναι; μ’ερωτάς, συνεχίζει, τι εστί το βέλτιστον τοις ανθρώποις, και τι των πάντων αιρετώτατον- μάθε το λοιπόν, και σκάσε:

μετ’αγνοίας των οικείων κακών αλυπότατος ο βίος. Άριστον γάρ πάσι και πάσαις το μη γενέσθαι. Δεύτερον δε το γενομένους αποθανείν ως τάχιστα.

Ο λάθος τρόπος ερμηνείας της δύναμης.

Έχουμε αναρωτηθεί ποιόν άνθρωπο θεωρούμε δυνατό; Να είμαστε ειλικρινείς. Ξεκινάμε από τους συνειρμούς που συντροφεύουν τη δύναμη στο μυαλό μας: Πλούσιος, άνθρωπος με κύρος και επιρροή, γοητεία σε κάθε του πτυχή. Ισχυρός είναι ένας άνθρωπος που ελέγχει άλλους, που οι άλλοι εξαρτώνται από τη δική του συμπεριφορά. Άρα; Είναι ένας άνθρωπος ισχυρός, όταν μπορεί να παίρνει και να κατακτά. Όση μεγαλύτερη είναι η ικανότητα «απόκτησης» του ανθρώπου αυτού, τόσο πιο εύκολα τον χαρακτηρίζουμε «ισχυρό».

Υπάρχει και άλλη μια ερμηνεία για την δύναμη. Είναι αυτή της αντοχής και της ανθεκτικότητας. Σύμφωνα με αυτήν την ερμηνεία, θεωρούμε ισχυρό έναν άνθρωπο ο οποίος αντιμετωπίζει με θάρρος τα προβλήματα, τις αντιξοότητες και τις κακουχίες. Τον υπομονετικό, τον πεισματάρη, τον θαρραλέο και εκείνον που δε «σπάει», με ό,τι και αν συγκρουστεί. Και οι δύο ερμηνείες, έχουν κάποιο σωστό υπόβαθρο. Η δύναμη έχει και αυτές τις μορφές. Είναι όμως μόνο αυτές οι μορφές που έχει η δύναμη;

Το να δίνουμε το θεωρούμε απώλεια…
Έχοντας αυτές τις αντιλήψεις για τη δύναμη, εγκλωβιζόμαστε σε αυτές. Φτιάχνουμε ένα ολόκληρο σκεπτικό, μια ολόκληρη κοσμοθεωρία και την κάνουμε τελικά, τρόπο ζωής. Οι δυσκολίες και τα απρόβλεπτα της ζωής που πλαισιώνονται από έναν τρομερό ανταγωνισμό, μας κάνουν συχνά να μην καταφέρνουμε να αποκτήσουμε αυτά που θέλουμε. Επομένως, η δύναμη απόκτησης πάει…περίπατο.

Ο αμέσως επόμενος στόχος μας λοιπόν, ποιός είναι; Να μη χάσουμε και αυτά που έχουμε. Όλα γύρω από την “κτήση” αφού την δύναμη την έχουμε ταυτίσει με αυτή. Έτσι λοιπόν, ενεργοποιούμε τη δεύτερη ερμηνεία που αναφέραμε πιο πάνω: Την αντοχή και την ανθεκτικότητα. Προσπαθούμε να προστατέψουμε τις έως τώρα δυνάμεις μας. Σαν πολύ «αμυντικό» δεν είναι αυτό το σκεπτικό; Όταν νιώθουμε σαν «κάβουρες» φοβούμενοι μη χάσουμε όσα έχουμε, τότε παύουμε να δίνουμε. Το να δίνουμε, το νιώθουμε ως «ήττα», ως «απώλεια».

Να δίνουμε, τίποτε άλλο.
Κάποιος ανώνυμος ποιητής, έγραψε «όποιος ξέρει να δίνει, μόνο αυτός θα σωθεί». Πώς γίνεται όμως αυτό; Είναι δύναμη το να δίνεις; Πώς μπορεί να είναι πραγματικότητα;

Όταν δίνουμε, σημαίνει ότι έχουμε. Η δύναμη άλλωστε στο μυαλό μας, έχει την έννοια της κατοχής. Αν έχουμε λοιπόν, δίνουμε. Όταν δίνουμε συνεχώς σημαίνει ότι είμαστε πλεονασματικοί. Η δύναμη έχει και άλλες μορφές όπως είπαμε. Μια από αυτές, είναι η έλλειψη φόβου απέναντι στην απώλεια. Όταν δίνουμε, σημαίνει πως δε φοβόμαστε ότι θα μας ξεγελάσουν, ότι θα μας προδώσουν κτλ.

Σημαίνει ότι ασπαζόμαστε το «κάνε το καλό και ρίχτο στο γιαλό». Υπάρχει και κάτι άλλο με το να δίνουμε. Ποιό είναι; Μέσα από την προσφορά μας, «αναπαράγουμε» τον εαυτό μας. Ξέρουμε ότι η βοήθεια που θα δώσουμε σε κάποιον άλλο, θα αξιοποιηθεί από εκείνον. Η προσφορά μας, είναι κομμάτι του εαυτού μας. Είναι μαγικό να ξέρουμε πως ο εαυτός μας ταξιδεύει μέσω όσων βοηθούμε!

Είναι τελικά η προσφορά αυτή που μας κάνει πάμπλουτους και ισχυρούς!

Η Ανταρκτική χάνει μέρος από το κράτημά της όπως δείχνουν μετρήσεις από δορυφόρο της ESA

Η αποστολή CryoSat της ESA (Ευρωπαϊκή Υπηρεσία Διαστήματος) έχει αποκαλύψει ότι κατά τα τελευταία επτά χρόνια, η Ανταρκτική έχει χάσει μια περιοχή του υποθαλάσσιου πάγου του μεγέθους του Μείζονος Λονδίνου. Αυτό γίνεται επειδή θερμό νερό του ωκεανού κάτω από τα επιπλέοντα άκρα της ηπείρου κατατρώει τον πάγο που προσκολλάται στον πυθμένα.

Οι περισσότεροι παγετώνες της Ανταρκτικής ρέουν κατευθείαν στον ωκεανό σε βαθιά υποβρύχια κοιλώματα. Το μέρος όπου η βάση τους αφήνει τον πυθμένα και αρχίζουν να επιπλέουν είναι γνωστό ως γραμμή γείωσης. [Η επίδραση της γραμμής γείωσης στην επιφάνεια φαίνεται στη μικρή εικόνα που συνοδεύει το κείμενο]. Αυτές ο γραμμές γείωσης τυπικά βρίσκονται ένα χιλιόμετρο ή και περισσότερα κάτω από το επίπεδο της θάλασσας και είναι απροσπέλαστες ακόμη και για τα υποβρύχια, έτσι είναι εξαιρετικά πολύτιμες μέθοδοι ανίχνευσής τους από μακριά.

Εργασία που δημοσιεύθηκε χθες στο Nature Geoscience περιγράφει πώς χρησιμοποιήθηκε η αποστολή CryoSat για να χαρτογραφήσει την κίνηση γραμμής γείωσης κατά μήκος 16 000 χιλιομέτρων της Ανταρκτικής ακτογραμμής. Η έρευνα, υπό την ηγεσία του Hannes Konrad από το Κέντρο για Παρατήρηση του Πόλου και Μοντελοποίηση του Πανεπιστημίου του Leeds στο Ηνωμένο Βασίλειο, δείχνει ότι μεταξύ 2010 και 2017 ο Νότιος Ωκεανός έλιωσε 1463 τετραγωνικά χιλιόμετρα του υποθαλάσσιου πάγου.

Η ομάδα παρακολούθησε της κίνηση της γραμμής γείωσης της Ανταρκτικής χάρις στην CryoSat και παρήγαγε τον πρώτο πλήρη χάρτη που δείχνει πώς αυτή η υποβρύχια άκρη χάνει το κράτημά της στον πυθμένα. Οι μεγαλύτερες αλλαγές φάνηκαν στην Δυτική Ανταρκτική, όπου περισσότερο από ένα πέμπτο του φύλλου του πάγου έχει υποχωρήσει σε όλη την έκταση του πυθμένα ταχύτερα από το ρυθμό εξαφάνισης του πάγου από την τελευταία εποχή των παγετώνων.

«Η μελέτη μας παρέχει σαφή στοιχεία ότι η υποχώρηση συμβαίνει κατά μήκος του φύλλου του πάγου λόγω της ωκεάνιας τήξης στη βάση του και όχι μόνο σε λίγα σημεία που έχουν χαρτογραφηθεί πριν από τώρα. Η υποχώρηση αυτή έχει τεράστιο αντίκτυπο στους εσωτερικούς παγετώνες, επειδή η απελευθέρωσή τους από τον πυθμένα αφαιρεί τις τριβές, κάνοντάς τους να επιταχυνθούν και να συνεισφέρουν στην άνοδο του παγκόσμιου επιπέδου της θάλασσας», αναφέρει ο Dr Konrad.

Παρόλο που η CryoSat σχεδιάστηκε για να μετρήσει αλλαγές στην υπερύψωση του φύλλου του πάγου, αυτό μπορεί να μεταφραστεί σε οριζόντια κίνηση στην γραμμή γείωσης χρησιμοποιώντας την αρχή του Αρχιμήδη, αλλά και σε γνώση της γεωμετρίας του παγετώνα και του πυθμένα. Οι ερευνητές βρήκαν επίσης μια μη αναμενόμενη συμπεριφορά. Αν και η υποχώρηση του παγετώνα Thwaites στη Δυτική Ανταρκτική έχει επιταχυνθεί στον γειτονικό παγετώνα Pine Island – μέχρι πρόσφατα έναν με τη ταχύτερη υποχώρηση στην ήπειρο – έχει σταματήσει. Αυτό υπονοεί ότι η ωκεάνια τήξη στη βάση του έχει σταματήσει.

«Οι διαφορές αυτές τονίζουν της πολύπλοκη φύση της αστάθειας του φύλλου του πάγου κατά μήκος της ηπείρου και η δυνατότητα ανίχνευσής τους μας βοηθάει να εντοπίσουμε περιοχές που αξίζουν περαιτέρω διερεύνηση», προσθέτει ο Dr Konrad. «Είμαστε ενθουσιασμένοι για το πόσο καλά η CryoSat μπορεί ανιχνεύσει την κίνηση των γραμμών γείωσης της Ανταρκτικής», είπε ο Andy Shepherd, ένας από τους συγγραφείς της μελέτης. «Είναι αδύνατες θέσεις για πρόσβαση από κάτω, έτσι είναι ένα φανταστικό παράδειγμα της αξίας των μετρήσεων του δορυφόρου για να προσδιοριστεί και να κατανοηθεί η περιβαλλοντική αλλαγή».

Ο διευθυντής της αποστολής της ESA, CryoSat, Tommaso Parrinello πρόσθεσε: «Αν και η CryoSat πλησιάζει τώρα τον όγδοο της χρόνο σε τροχιά – περισσότερο από το διπλάσιο του προβλεπόμενου χρόνου ζωής της – είναι υπέροχο να βλέπεις ότι η αποστολή μπορεί ακόμη να πραγματοποιεί μετρήσεις υψηλότερης ποιότητας και να επιτρέπει νέες ανακαλύψεις στην επιστήμη που ασχολείται με τους πόλους».

Πόσα μυστικά ακόμη κρύβει το DNA;

Είναι το πιο μελετημένο, το πιο πολυφωτογραφημένο και το πλέον αναγνωρίσιμο χημικό μόριο.

Και αν αναλογισθεί κανείς ότι υπάρχουμε χάρη στις μοναδικές ικανότητές του (σταθερότητα, δυνατότητα αυτοαναπαραγωγής, λειτουργικότητα ως παρακαταθήκη κωδικοποιημένης πληροφορίας), τότε το DNA μάλλον αξίζει τη διασημότητα που απολαμβάνει.

Φαντασθείτε λοιπόν την έκπληξη των επιστημόνων που μελετούν το μόριο στο οποίο είναι γραμμένες οι οδηγίες για τη δημιουργία όλων των ζωντανών οργανισμών που υπάρχουν στον πλανήτη Γη, όταν ανακάλυψαν ότι στο DNA υπάρχουν περισσότεροι του ενός κώδικες. Ειδικότερα, οι αλληλουχίες του που λειτουργούν ως κωδικοποιημένη πληροφορία για τη σύνθεση των πρωτεϊνών μπορούν επίσης να χρησιμοποιούνται και ως ρυθμιστικές.

Με άλλα λόγια, οι αλληλουχίες αυτές παίρνουν μέρος στο παιχνίδι της διοίκησης: καθορίζουν ποια χρονική στιγμή και σε ποιο κύτταρο θα συντεθούν αυτές οι πρωτεΐνες.

Τώρα αν διερωτάσθε πώς είναι δυνατόν να υπάρχουν περισσότεροι του ενός κώδικες γραμμένοι στο ίδιο μόριο και πώς αυτό επέδρασε κατά τη διάρκεια της εξέλιξης, οι ερευνητές το παραδέχονται: το εύρημά τους απαντά μεν σε ερωτήματα του παρελθόντος αλλά γεννά ακόμη περισσότερα.

Μετά την πλήρη αποκωδικοποίησή του, θα περίμενε κανείς ότι οι ερευνητές γνωρίζουν το DNΑ σαν την παλάμη τους. Στο κάτω-κάτω η αποκωδικοποίηση, η οποία ολοκληρώθηκε στα πρώτα χρόνια του αιώνα που διανύουμε, δεν ήταν παρά το αποκορύφωμα μιας σειράς ερευνητικών προσπαθειών οι οποίες κατά το δεύτερο μισό του 20ού αιώνα αποκάλυψαν τον κεντρικό ρόλο που διαδραματίζει το μόριο της ζωής και της κληρονομικότητας. Όλα όμως δείχνουν ότι το DNA κρατά ακόμη πολλά μυστικά και ότι 60 χρόνια εντατικής έρευνας δεν ήταν αρκετά για να τα αποκαλύψουν.

Μόλις τον περασμένο μήνα έκπληκτοι οι ερευνητές διαπίστωσαν ότι η κωδική γλώσσα του DNA είναι διττή! Ναι, οι αλληλουχίες του DNA στις οποίες είναι εγγεγραμμένες οι πληροφορίες για τη σύνθεση των πρωτεϊνών μπορούν ταυτόχρονα να ελέγχουν και τις εντολές σχετικά με το πού και πότε θα συντεθούν αυτές οι πρωτεΐνες.

Πώς μπορούν να υπάρχουν όμως δύο κώδικες στο ίδιο τμήμα του γενετικού υλικού; Και δεν υπάρχει «σύγκρουση συμφερόντων» ανάμεσά τους; Τα ερωτήματα που γεννώνται είναι τόσο πολλά και οι απαντήσεις είναι βέβαιον ότι θα επανασχεδιάσουν τον γενετικό μας χάρτη.

Το «σπάσιμο» του κώδικα της ζωής
Αλλά ας πάρουμε τα πράγματα από την αρχή: αμέσως μετά την αποκάλυψη της δομής του DNA από τους Watson και Crick έγινε φανερό ότι το μόριο αυτό μπορούσε όντως να λειτουργήσει ως κώδικας, ο οποίος είχε μάλιστα την ικανότητα να αυτοαναπαράγεται (καθώς η συμπληρωματικότητα των δύο αλυσίδων της διπλής έλικας επέτρεπε τη δημιουργία της μιας από την άλλη).

Επρόκειτο δε για έναν σχετικά απλό κώδικα, αν σκεφθεί κανείς ότι αποτελούνταν από τέσσερα μόνο σύμβολα: τα Α, Τ, G, C που είναι τα αρχικά στην αγγλική για τις τέσσερις βάσεις (αδενίνη, θυμίνη, γουανίνη και κυτοσίνη), οι οποίες στο μόριο του DNA «διανθίζουν» τον φωσφορικό σκελετό του. Ενα κωδικοποιημένο μήνυμα στη γλώσσα του DNΑ λοιπόν δεν θα ήταν παρά μια αλληλουχία από τα παραπάνω γράμματα. Παραδείγματος χάριν: ATTGCCGTATATGGTAAATGCCAGTGTTTACACGTG…

Στην πραγματικότητα αυτό που έκαναν οι επιστήμονες που αποκωδικοποίησαν το ανθρώπινο γονιδίωμα δεν ήταν παρά να βρουν με ποια σειρά τοποθετούνταν τα 3 δισεκατομμύρια των βάσεων στις οποίες είναι καταγεγραμμένες οι οδηγίες για τη δημιουργία των ανθρώπων.

Το σπάσιμο του κώδικα αυτού είχε αρχίσει μερικές δεκαετίες πριν, όταν οι πρωτοπόροι της μοριακής βιολογίας αποδείκνυαν ότι κάθε τριπλέτα αυτού του κώδικα αντιστοιχούσε σε ένα αμινοξύ μιας πρωτεΐνης. Παραδείγματος χάριν, η τριπλέτα ATG είναι ο κωδικός για το αμινοξύ μεθειονίνη το οποίο τοποθετείται πάντοτε στην αρχή των πρωτεϊνών καθιστώντας την τριπλέτα αυτή τριπλέτα έναρξης του κωδικοποιημένου μηνύματος.

Όλοι οι δυνατοί συνδυασμοί για την τοποθέτηση των 4 γραμμάτων σε σειρά των τριών είναι 64 (43). Τα αμινοξέα όμως που υπάρχουν σε όλες μας τις πρωτεΐνες δεν είναι παρά μόνο είκοσι. Όπως λοιπόν διαπιστώθηκε πολύ νωρίς, ορισμένα αμινοξέα κωδικοποιούνται από περισσότερες τριπλέτες (παραδείγματος χάριν, το αμινοξύ ισολευκίνη κωδικοποιείται από τις τριπλέτες ΑΤΤ, ΑΤC και ATA), ενώ υπάρχουν και τρεις τριπλέτες που λειτουργούν ως κωδικοί λήξης του κωδικοποιημένου μηνύματος και κατ’ επέκταση της πρωτεϊνοσύνθεσης.

Η ύπαρξη περισσοτέρων του ενός κωδικών για ορισμένα αμινοξέα δεν ξένισε τους ερευνητές. Το αντίθετο! Ηταν μάλλον αναμενόμενη, καθώς παρέχει έναν βαθμό ελευθερίας που είναι ζωτικής σημασίας.

Πολλές φορές λοιπόν ένα λάθος στην αντιγραφή του DNA μπορεί να μην έχει κανέναν αντίκτυπο στη δομή και στη λειτουργία της παραγόμενης υπό τις οδηγίες του πρωτεΐνης. Ετσι στο παράδειγμα της ισολευκίνης, ένα λάθος που θα μετέτρεπε το τρίτο γράμμα της τριπλέτας από Α σε Τ ή σε C δεν θα άλλαζε την οδηγία: και πάλι η πρωτεΐνη θα είχε ισολευκίνη στη δεδομένη θέση.

Οι επικίνδυνες αλλαγές
Φυσικά δεν είναι όλες οι αλλαγές του κώδικα εξίσου ακίνδυνες για την τύχη των πρωτεϊνών και των οργανισμών που τις φέρουν. Παραδείγματος χάριν, αρκεί μόνο μια αλλαγή (μετάλλαξη στη γλώσσα των βιολόγων) ενός και μόνο γράμματος στο DNA που κωδικοποιεί για τη σύνθεση της αιμοσφαιρίνης και η παραγόμενη πρωτεΐνη δεν είναι λειτουργική, με αποτέλεσμα την εμφάνιση της μεσογειακής αναιμίας.

Στα πρώιμα χρόνια της μοριακής βιολογίας οι ερευνητές χώρισαν το DNA σε χρήσιμο (αυτό που περιείχε γονίδια, κωδικές αλληλουχίες για τη σύνθεση των πρωτεϊνών) και μη. Αυτό το δεύτερο το θεώρησαν τόσο άχρηστο ώστε το ονόμασαν σκουπίδι (junk DNA).

Βαθμηδόν όμως κατάλαβαν ότι μακράν τού να είναι άχρηστο το DNA αυτό, το οποίο παρεμβάλλεται ανάμεσα στα γονίδια, παίζει σημαντικότατο ρόλο λαμβάνοντας μέρος σε καίριες αποφάσεις σχετικά με το πότε και πού θα εκφραστεί ένα γονίδιο (και κατ’ επέκταση σε ποιον κυτταρικό τύπο και σε ποια χρονική στιγμή θα παραχθεί μια συγκεκριμένη πρωτεΐνη).

Αναγνωρίζοντας συγκεκριμένες αλληλουχίες (μήκους μεγαλυτέρου των τριών βάσεων) σε αυτό το DNA μόρια της πρωτεϊνοσυνθετικής μηχανής του κυττάρου προσδένονται πάνω του προκειμένου να επιτελέσουν τον ρόλο τους.

Μέχρι πρότινος λοιπόν τα πράγματα ήταν ξεκάθαρα: ένα μικρό μόνο μέρος των τριών δισεκατομμυρίων βάσεων του DNA μας είχε κωδικό ρόλο, αντιστοιχούσε δηλαδή στα περίπου 20.500 γονίδιά μας. Το υπόλοιπο εμπλεκόταν στη ρύθμιση της έκφρασης των γονιδίων, ενώ ένα μέρος του είχε και δομικό ρόλο.

Φανταστείτε λοιπόν την έκπληξη των ερευνητών του Πανεπιστημίου της Ουάσιγκτον στο Σιάτλ των ΗΠΑ όταν διαπίστωσαν ότι οι «αρμοδιότητες» δεν ήταν τόσο ξεκάθαρες. Οπως χαρακτηριστικά δήλωσε μιλώντας στο «Βήμα» ο αναπληρωτής καθηγητής Επιστημών του Γονιδιώματος και Ιατρικής και επικεφαλής των ερευνών έλληνας βιολόγος Γιάννης Σταματογιαννόπουλος, «αυτός ο διαχωρισμός δεν αποδίδει πια την πραγματικότητα».

Ο διττός κωδικεύων ρόλος
Η ερευνητική ομάδα του κ. Σταματογιαννόπουλου συμμετέχει στο διεθνές ερευνητικό πρόγραμμα ENCODE, το οποίο έχει στόχο να εντοπίσει μεταξύ άλλων και τις περιοχές του γονιδιώματος με ρυθμιστικό ρόλο στην έκφραση των γονιδίων. Εφαρμόζοντας κατάλληλες μοριακές τεχνικές οι ερευνητές χαρτογραφούν σπιθαμή προς σπιθαμή το γενετικό υλικό.

Οπως ανέφεραν λοιπόν στο σχετικό άρθρο τους, το οποίο δημοσιεύθηκε στην επιθεώρηση «Science», η αλληλουχία του DNA που λειτουργεί ως κωδική πληροφορία για τη σύνθεση των πρωτεϊνών (τα εξόνια στη γλώσσα των βιολόγων) μπορεί επίσης να χρησιμεύσει και ως κωδικός για παράγοντες που ρυθμίζουν την έκφραση των γονιδίων (μεταγραφικοί παράγοντες, transcription factors).

«Διαπιστώσαμε ότι ένα ποσοστό της τάξεως του 15% των εξονίων έχει διττό κωδικεύοντα ρόλο» δήλωσε μιλώντας ο έλληνας ερευνητής και εξήγησε: «Εκτός από το να μεταγράφεται σε RNA για να χρησιμεύσει στη σύνθεση των πρωτεϊνών, αποτελεί και σημείο πρόσδεσης μορίων που ρυθμίζουν πότε και πού θα εκφραστούν τα γονίδια».

Τις περιοχές διπλής ανάγνωσης οι ερευνητές τις ονόμασαν duons (δυόνια, σε ελεύθερη απόδοση) και η ύπαρξή τους αλλάζει τη θεώρησή μας για τις γενετικές ασθένειες. «Ως σήμερα πιστεύαμε ότι μια μετάλλαξη που προκαλούσε αλλαγή στη σειρά αμινοξέων μιας πρωτεΐνης ευθυνόταν για την εμφάνιση μιας γενετικής ασθένειας.

Τώρα θα πρέπει να επανεξετάσουμε τον ρόλο αυτής της μετάλλαξης και στην έκφραση των γονιδίων. Με άλλα λόγια, η μετάλλαξη ευθύνεται μεν για την εμφάνιση της νόσου αλλά αυτό διαμεσολαβείται ίσως μέσω της επίδρασής της στην έκφραση των γονιδίων και όχι στην αλλαγμένη πρωτεΐνη» σημείωσε ο κ. Σταματογιαννόπουλος.

ΕΞΕΛΙΞΗ
Ακολουθώντας το νήμα της ζωής
Μία από τις εντυπωσιακότερες στιγμές σε ένα εργαστήριο βιολογίας είναι η απομόνωση του DNA ενός οργανισμού: λίγες σταγόνες αίμα ή μερικά φύλλα ενός φυτού, ένζυμα που θα σπάσουν τα κυτταρικά τοιχώματα και εκχυλίσεις που θα απομακρύνουν τα λιπίδια και τις πρωτεΐνες των κυττάρων, και η πολυπόθητη στιγμή φθάνει.

Το DNA παρουσία άλατος και αιθανόλης κατακρημνίζεται στον πυθμένα του δοκιμαστικού σωλήνα δημιουργώντας ίνες που χορεύουν στα κύματα της αλκοόλης. Η δημιουργία ινών που είναι ορατές με γυμνό μάτι δεν είναι τυχαία. Το DNA είναι ένα γραμμικό μεγαλομόριο το οποίο μέσα στα κύτταρά μας είναι, τον περισσότερο καιρό, πολύ σφιχτά πακεταρισμένο.

Αυτή η γραμμική εικόνα του DNA, η οποία με ακολουθεί από το πανεπιστήμιο (τότε που στα εργαστήρια του μαθήματος της Μοριακής Βιολογίας οι φοιτητές βλέπουν επιτέλους την «πρώτη ύλη» των σπουδών τους), έχει γεννήσει στο μυαλό μου μιαν άλλη: αν σκεφθεί κανείς ότι ο καθένας από εμάς περιέχει DNA από τον πατέρα του και τη μητέρα του, και εκείνοι με τη σειρά τους το DNA των δικών τους γονέων, μπορεί να φανταστεί ότι όλοι οι άνθρωποι, ζώντες και μη, είμαστε συνδεδεμένοι με μιαν αόρατη κλωστή, αυτήν που κληρονομούμε από τους γονείς μας και την κληροδοτούμε στα παιδιά μας.

Αν επεκτείνει κανείς αυτή τη νοητή κλωστή στο παρελθόν, θα φθάσει σε μια πρώτη διακλάδωση, στον κοινό πρόγονο του ανθρώπου με τα άλλα πρωτεύοντα θηλαστικά. Αν συνεχίσει τη διαδρομή, έπειτα από συνεχείς διακλαδώσεις θα φθάνει σε όλο και πιο απομακρυσμένους από εμάς μεν, απολύτως προγόνους μας δε.

Δεν υπάρχει μεγαλύτερη απόδειξη για την ορθότητα της θεωρίας του Δαρβίνου από την ύπαρξη του DNA! Είτε προέρχεται από βακτήρια, είτε από άνθρωπο, είτε από φυτά είτε από θαλάσσιους οργανισμούς, απαρτίζεται πάντοτε από τα ίδια τέσσερα γράμματα και λειτουργεί πάντοτε ως ο κώδικας στον οποίο είναι γραμμένη η συνταγή για τη δημιουργία ενός νέου ατόμου.

Εκμεταλλευόμενοι ακριβώς αυτή τη γραμμική συνέχεια των ειδών, οι ερευνητές εξάγουν πολύτιμα συμπεράσματα συγκρίνοντας το γενετικό υλικό τους. Αυτό έκανε πρόσφατα και η ομάδα τού ελληνικής καταγωγής βιολόγου Ανδρέα (Αντυ) Μπαξεβάνη, ο οποίος ηγείται της Μονάδας Υπολογιστικής Γενομικής των Εθνικών Ινστιτούτων Υγείας (National Institutes of Health, NIH) των ΗΠΑ.

Για την ακρίβεια, η ερευνητική ομάδα συνέκρινε το γονιδίωμα του κτενοφόρου Mnemiopsis leidyi (ενός θαλάσσιου οργανισμού του Ατλαντικού που μοιάζει αλλά δεν είναι μέδουσα) με είδη αντιπροσωπευτικά άλλων μεγάλων τάξεων και ξαναέγραψε την εξελικτική ιστορία μας.

Όπως αναφέρεται στο άρθρο της ερευνητικής ομάδας στην επιθεώρηση «Science» (13 Δεκεμβρίου 2013), τα ευρήματά τους όχι μόνο ρίχνουν τους σπόγγους από το βάθρο τους (θεωρούνταν ως οι πρώτοι πολυκύτταροι πρόγονοί μας), αλλά αποδεικνύουν και ότι η εξέλιξη δεν είναι μια γραμμική πορεία από το απλούστερο στο συνθετότερο.

Ειδικότερα, ο κ. Μπαξεβάνης και οι συνεργάτες του διαπίστωσαν ότι τα κτενοφόρα (τα οποία πήραν το όνομά τους από τις χαρακτηριστικές δομές που τα βοηθούν στην κολύμβηση και οι οποίες μοιάζουν με χτένες) είναι αρχαιότερα από τους σπόγγους, παρά το γεγονός ότι οι σπόγγοι έχουν απλούστερη μορφολογία.

Έτσι, τα αρχαιότερα κτενοφόρα φέρουν νευρικό και μυϊκό σύστημα, το οποίο έχασαν οι μεταγενέστεροι σπόγγοι.

Ο Αριστοτέλης και η μεσαία τάξη ως ρυθμιστής του άριστου πολιτεύματος

Από τη στιγμή που αναλύθηκαν όλα τα είδη των πολιτευμάτων (και οι παρεκβάσεις τους), αυτό που απομένει είναι η διερεύνηση του άριστου πολιτεύματος: «Ποιο όμως είναι το άριστο πολίτευμα και ποιος ο άριστος βίος για τις περισσότερες πόλεις και για τους περισσότερους ανθρώπους, όχι με βάση την εξαιρετική αρετή που υπερβαίνει την αρετή του συνηθισμένου ατόμου, ούτε με βάση την παιδεία η οποία προϋποθέτει φυσικά χαρίσματα και ευνοϊκή τύχη, ούτε με βάση ένα πολίτευμα όπως το ευχόμαστε, αλλά με βάση το είδος ζωής που είναι εφικτό να έχουν οι περισσότεροι, και το είδος πολιτεύματος που ενδέχεται να υιοθετήσουν οι περισσότερες πόλεις;»
 
            Ο συνδυασμός του άριστου πολιτεύματος με τον άριστο βίο είναι η κατάδειξη της ενότητας ανάμεσα στην ατομική και πολιτική αρετή. Η πόλη, ως σύνολο ανθρώπων, για να μπορέσει να οργανωθεί, πρέπει ο κάθε πολίτης ξεχωριστά να αποδεχτεί και να εφαρμόσει τους κανόνες. Η ηθική αρετή σε ατομικό επίπεδο είναι η προϋπόθεση της αρετής σε δημόσιο επίπεδο. Ένα πλήθος από λωποδύτες είναι αδύνατο να προτάξει την πολιτειακή ακεραιότητα. Κι αυτός είναι ο ρόλος της παιδείας που πρέπει να μεταδώσει στους νέους την ηθική αρετή, ώστε να διασφαλιστεί η κοινωνική συνοχή με την εφαρμογή των νόμων. Η αναγνώριση ότι η παιδεία αφορά τα φυσικά χαρίσματα του μαθητή και την ευνοϊκή τύχη, είναι η παραδοχή της ταξικής διάστασης της παιδείας, αφού η τύχη δεν είναι τίποτε άλλο από την κοινωνική θέση που θα παίξει τεράστιο ρόλο. Η επιλογή δασκάλου, η ανάγκη αποχής από κάθε άλλη εργασία, τα οικογενειακά ερεθίσματα και οι προτεραιότητες που ορίζονται πρωτίστως από τους γονείς είναι ξεκάθαρα ταξικά στοιχεία που εν τέλει διαμορφώνουν την εκπαίδευση. Κι αυτή την παράμετρο ο Αριστοτέλης ονομάζει τύχη, αφού κανείς δεν μπορεί να επιλέξει την οικογένεια που θα γεννηθεί. Αν συνυπολογίσουμε ότι και αυτά που αναφέρονται ως «φυσικά χαρίσματα», εννοώντας προφανώς την ευφυΐα ή τη δυνατότητα συγκέντρωσης ή οτιδήποτε άλλο συμβάλλει θετικά στην εκπαιδευτική πρόοδο του μαθητή, αφορούν επίσης σε μεγάλο βαθμό το κοινωνικό περιβάλλον που προσδίδει τα ερεθίσματα, αντιλαμβανόμαστε ότι ο βαθμός της τύχης παίζει τον πιο καθοριστικό ρόλο. Γι’ αυτό, πολύ βασικός στόχος κάθε υγιούς πολιτεύματος είναι η παροχή ίσων εκπαιδευτικών ευκαιριών σε όλους τους νέους, που μόνο με την άμβλυνση των ταξικών διαφορών μπορεί να επιτευχθεί. Γιατί η εκπαίδευση είναι αδύνατο να αποκοπεί από τους ταξικούς διαχωρισμούς – πράγμα που ο Αριστοτέλης αντιλαμβανόταν πολύ καλά παρακολουθώντας την αθηναϊκή πραγματικότητα της εποχής του. Οι εκπαιδευτικές ανισότητες δεν είναι παρά ταξικές ανισότητες που μ’ αυτό τον τρόπο διαιωνίζονται.
 
            Και βέβαια, οι πολιτειακές παρεμβάσεις αυτού του είδους, απαιτούν συγκεκριμένες τακτικές και κυρίως την πρακτική ευκολία στην εφαρμογή τους, ώστε να μπορούν να υιοθετηθούν από τις περισσότερες πόλεις. Κι αυτός είναι ο δρόμος της μεσότητας: «Εάν δηλαδή είναι σωστή η άποψη των Ηθικών ότι ο ευτυχισμένος βίος είναι ο βίος ο εναρμονισμένος με την αρετή και η αρετή είναι η μεσότητα, τότε κατά λογική αναγκαιότητα ο βίος που χαρακτηρίζεται από τη μεσότητα είναι άριστος, με την έννοια ότι είναι δυνατόν κάθε άνθρωπος να πετύχει τη μεσότητα». Από τη στιγμή που η μεσότητα εγγυάται τις ισορροπίες σε ατομικό επίπεδο οδηγώντας στην αρετή κι εφόσον η συνύπαρξη καθορίζεται από τις σχέσεις όλων των μεμονωμένων προσωπικοτήτων, που πρέπει να κατέχουν την ατομική αρετή μέσω της μεσότητας, δε μένει παρά να δεχτούμε ότι το κλειδί της σωστής πολιτικής οργάνωσης που θα εξασφαλίσει τη συλλογική ευτυχία είναι και πάλι η μεσότητα που θα επιβάλει τις ισορροπίες: «Και αυτά τα ίδια κριτήρια υποχρεωτικά ισχύουν για την αρετή και την κακία της πόλης και του πολιτεύματος, γιατί το πολίτευμα είναι ένας συγκεκριμένος τρόπος ζωής της πόλης».
 
            Με δεδομένο ότι τα πολιτεύματα διαχωρίζονται κυρίως από τον ταξικό τους προσανατολισμό δεν είναι δύσκολο να συμπεράνει κανείς ότι ακριβώς αυτό είναι και το πεδίο της μεσότητας που πρέπει να διεκδικηθεί ως κοινωνικό αγαθό: «Κάθε πόλη γενικά αποτελείται από τρία μέρη, από τους πολύ εύπορους, από τους πολύ άπορους και από τους τρίτους που βρίσκονται στη μέση αυτών των δύο. Καθώς, λοιπόν, κατά κοινή ομολογία το μέτριο και το μέσο είναι το άριστο, γίνεται φανερό ότι από όλα τα δώρα της τύχης η μέση ιδιοκτησία είναι η καλύτερη». Κι όταν ο Αριστοτέλης λέει ότι «η μέση ιδιοκτησία είναι η καλύτερη», εννοεί ότι είναι καλύτερη και σε ατομικό και σε συλλογικό επίπεδο. Γιατί ο άνθρωπος μπορεί να κατακτήσει την ευτυχία μόνο εντασσόμενος στο συμβιωτικό πλαίσιο της συναναστροφής. Ως φύσει πολιτικό ον είναι αδύνατο να συλλάβει την ευτυχία αν δε συνειδητοποιήσει τις ισορροπίες που τον καθιστούν αποδεκτό από τους γύρω. Κι εδώ δε γίνεται λόγος για τη φτηνή συναναστροφή της κολακείας που μόνο το συμφέρον επιβάλλει. Εδώ μιλάμε για τον καθορισμό του εαυτού που οφείλει να ενταχθεί μέσα στο συλλογικό γίγνεσθαι, δηλαδή για την αυτογνωσία, που αποκτά κοινωνικές διαστάσεις: «ο μέσος πλούτος πολύ εύκολα υπακούει στη λογική, ενώ ο άνθρωπος ο υπερβολικά ωραίος ή ισχυρός ή ευγενικής καταγωγής ή πλούσιος ή το αντίθετο, δηλαδή ο υπερβολικά φτωχός ή ανίσχυρος ή ταπεινής καταγωγής είναι δύσκολο να ακολουθήσει τη λογική».
 
            Τα άκρα, σε όλα τα επίπεδα, δεν μπορούν παρά να δράσουν αρνητικά, αφού, από θέση αρχής, ακυρώνουν τις ισορροπίες. Κι αυτό δεν αφορά μόνο τον πλούτο, αλλά και την ομορφιά και τη δύναμη και οτιδήποτε σχετίζεται με τη διαμόρφωση του ανθρώπου. Η υπερβολή είναι εύκολο να οδηγήσει στην υπεροψία και την αλαζονική συμπεριφορά, ενώ η έλλειψη στο αίσθημα της κατωτερότητας που είτε θα στραφεί απέναντι στους άλλους ως επιθετικότητα είτε απέναντι στον ίδιο τον εαυτό ως εκμηδένιση της αυτοπεποίθησης. Τελικά, όλα τα ενδεχόμενα υπονομεύουν την ανθρώπινη επαφή: «Γιατί οι πρώτοι γίνονται αλαζόνες και μεγαλοαπατεώνες μάλλον και οι δεύτεροι κακοποιοί και μικροαπατεώνες κυρίως. Έτσι άλλα αδικήματα οφείλονται στην αλαζονεία και άλλα στην κακοήθεια».
 
            Η κατανομή του πλούτου που επιφέρει χαοτικές κοινωνικές ανισότητες παρουσιάζεται ως ύψιστη παθογένεια, αφού σε κάθε περίπτωση δεν έχει άλλη επιλογή απ’ το να οδηγήσει στην αποδιοργάνωση. Από τη μια ο υπέρμετρος πλούτος γεννά την ακόρεστη επιθυμία για κέρδος (και κατ’ επέκταση για πολιτική εξουσία προς νομοθετική διασφάλιση όλων των μεθοδεύσεων) κι από την άλλη η φτώχεια γεννά την αδικία και την εξαθλίωση που ασφαλώς (επίσης) θα δράσουν αντικοινωνικά. Οι κοινωνικές δομές που δημιουργούν τις συνθήκες για την κατάλυση κι όχι την ισχύ του νόμου, είναι οι συνθήκες της στρέβλωσης, που θα μετατρέψουν το πολίτευμα σε πεδίο εξυπηρέτησης συμφερόντων. Γι’ αυτό και οι πλούσιοι θέλουν ολιγαρχία. Γι’ αυτό και οι φτωχοί παλεύουν για δημοκρατία. Κι αν δεν είναι το συμφέρον που κάνει τους πάντες να κόπτονται για την εξουσία, τότε είναι η υπέρμετρη φιλοδοξία που και πάλι τρέφεται από τα άκρα ως εσφαλμένη αντίληψη του εαυτού: «οι βρισκόμενοι στο μέσον ελάχιστα επιδιώκουν να αποφεύγουν ή να καταλαμβάνουν αξιώματα. Και οι δύο αυτές επιδιώξεις βλάπτουν τις πόλεις».
 
            Αν η αποφυγή των αξιωμάτων δηλώνουν την απογοήτευση από τον πολιτικό βίο που κάνει τους ανθρώπους να απομακρύνονται ή αν η επιδίωξη της πολιτικής καταξίωσης υπονοεί την υπηρεσία συμφερόντων ή της προσωπικής ματαιοδοξίας, δεν έχει να κάνει με το πεδίο που ερευνά εδώ ο Αριστοτέλης. Ούτε όμως γίνεται λόγος απλώς για τις προτιμήσεις ή τις κλίσεις των ανθρώπων, σύμφωνα με τις οποίες άλλοι θέλουν κι άλλοι δε θέλουν να συμμετέχουν στην πολιτική ζωή. Γιατί εδώ καθίσταται σαφές ότι αυτές ακριβώς οι κλίσεις διαμορφώνονται και, κατά συνέπεια, άλλοι μαθαίνουν να έχουν τέτοιες φιλοδοξίες, ενώ άλλοι όχι. Αν δεχτούμε ότι η παιδεία είναι αυτή που δημιουργεί την επιθυμία για συμμετοχή στο πολιτικό γίγνεσθαι, τότε βρισκόμαστε και πάλι μπροστά στην ανισότητα, αφού η παιδεία δεν είναι απαλλαγμένη από τις ταξικές διαφορές: «οι ευνοημένοι με υπερβολικά δώρα της τύχης, δύναμη, πλούτο, φίλους και άλλα παρόμοια, ούτε ανέχονται ούτε γνωρίζουν να υπακούν στην εξουσία (και αυτό καλλιεργείται από την παιδική ακόμη ηλικία στο οικογενειακό περιβάλλον. Εξαιτίας της πολυτελούς ζωής τους ούτε και στα σχολεία συνηθίζουν να υπακούν). Αντίθετα οι υπερβολικά φτωχοί είναι πολύ δουλοπρεπείς. Συνεπώς αυτοί δε γνωρίζουν να εξουσιάζουν, αλλά να εξουσιάζονται ως δούλοι από δεσποτική αρχή. Οι προηγούμενοι γνωρίζουν να μην υπακούν σε καμία εξουσία, αλλά μόνο να ασκούν οι ίδιοι δεσποτική εξουσία. Έτσι διαμορφώνεται μια πόλη δούλων και δεσποτών αλλά όχι ελεύθερων ανθρώπων, όπου άλλοι φθονούν κι άλλοι περιφρονούν».
 
            Το ενδεχόμενο της διεκδίκησης των θέσεων εξουσίας από ανάξιους, που είναι πρόθυμοι να χρησιμοποιήσουν όλα τα μέσα εξαναγκάζοντας τους πραγματικά χαρισματικούς να αποχωρήσουν, είναι η πιο στρεβλή εκδοχή όχι μόνο του πολιτεύματος, αλλά και της παιδείας – η παιδεία είναι το στήριγμα όλων των πολιτευμάτων – η οποία επιτρέπει τη διαστρέβλωση όλων των αξιών αναδεικνύοντας τους χειρότερους σε ηγέτες και μετατρέποντας το λαό σε υποχείριο, που είτε αδυνατεί να παρακολουθήσει τη στρέβλωση είτε την ανέχεται για την εξυπηρέτηση μικροσυμφερόντων.
 
            Οι ακραίες περιπτώσεις πλούτου και φτώχειας δεν μπορούν παρά να έχουν αντίκτυπο και στη διαχείριση της εξουσίας. Αυτομάτως όλα γίνονται θέμα συσχετισμών. Αν οι φτωχοί είναι πολλοί κι οργανωθούν μπορεί να προκύψει καμιά εξέγερση. (Αυτό βέβαια εξαρτάται κι απ’ το βαθμό της απελπισίας. Οι έξυπνες ολιγαρχίες είναι αυτές που ξέρουν ποια είναι τα όρια. Όσο πιο προκλητική γίνεται η ολιγαρχία τόσο πιο επίφοβη είναι η θέση της): «Όλα αυτά όμως απέχουν πάρα πολύ από τη φιλία και την πολιτική κοινωνία, γιατί η κοινωνία προϋποθέτει στοιχεία φιλίας, αφού οι άνθρωποι ούτε τον ίδιο δρόμο δε θέλουν να μοιράζονται με τους εχθρούς τους. Αντίθετα με αυτό, απαιτείται η πόλη να αποτελείται από ίσους και όμοιους πολίτες όσοι γίνεται περισσότερο, και αυτό συναντάται κυρίως στη μεσαία τάξη. Κατά συνέπεια άριστο πολιτικό βίο έχει η πόλη η οποία αποτελείται από όσα ισχυριστήκαμε ότι συνιστούν την πόλη σύμφωνα με τη φύση της».
 
            Η πρόθεση ενός πολιτεύματος να ακολουθήσει τη μεσότητα στη διανομή του πλούτου δεν μπορεί παρά να καταγράφεται από την ισχύ που δίνει στη μεσαία τάξη. Από τη στιγμή που ο υπέρμετρος πλούτος είναι αδύνατο να επιτευχθεί χωρίς την προϋπόθεση της υπέρμετρης φτώχειας, κι από τη στιγμή που και τα δύο αυτά αλληλένδετα ενδεχόμενα λειτουργούν σε βάρος της κοινωνικής συνοχής, δηλαδή του δημόσιου συμφέροντος, η γιγάντωση της μεσαίας τάξης είναι τα διαπιστευτήρια της ισότητας και της κοινωνικής ομαλότητας. Υπό αυτές τις συνθήκες η προσπάθεια εξαφάνισης ή συρρίκνωσης της μεσαίας τάξης δεν είναι παρά υπονόμευση της ενότητας της κοινωνίας, δηλαδή της ίδιας της πολιτείας.
 
            Όμως η μεσότητα δε σημαίνει και ισοπέδωση με την έννοια της απόλυτης περιουσιακής ισότητας. Δεν είναι τυχαίο ότι ο Αριστοτέλης υποστηρίζει της ιδιοκτησία ως μορφή αξιοκρατίας – αυτός που αξίζει ας έχει και τα περισσότερα. Δεν είναι όμως τυχαίο που υποστηρίζει επίσης ότι αυτές οι περιουσιακές διαφορές πρέπει εκδηλώνονται μέσα σε κάποια όρια. Γιατί αυτό που προέχει είναι το όφελος της πόλης και η ύπαρξη ενός υγιούς ανταγωνισμού στο πλαίσιο της περιουσιακής επέκτασης μπορεί να δράσει θετικά, αφού θα λειτουργήσει ως έναυσμα αξιοποίησης όλων των ικανοτήτων. (Φυσικά, με την προϋπόθεση ότι δεν παραβιάζονται οι νόμοι). Όταν όμως τα όρια χαθούν φέρνοντας στο προσκήνιο ανθρώπους με πλούτο χωρίς προηγούμενο (κι ως εκ τούτου με ανεξέλεγκτη δύναμη) τότε όλα ανατρέπονται, καθώς εξαφανίζονται οι ισορροπίες ανοίγοντας το δρόμο στις πολιτικές ακρότητες: «Άρα γίνεται φανερό ότι η πολιτική κοινωνία που αποτελείται από πολίτες της μέσης τάξης είναι άριστη, και ενδέχεται να έχουν σωστό πολιτικό βίο οι πόλεις όπου η μεσαία τάξη είναι μεγάλη και ισχυρότερη, μάλιστα σε σχέση με τις δύο άλλες ή τουλάχιστον με μία από τις δύο. Γιατί συμμαχώντας με αυτή πετυχαίνει η ισορροπία των δυνάμεων και εμποδίζει την εμφάνιση ακροτήτων στον πολιτικό βίο». Και ο Αριστοτέλης συμπληρώνει: «είναι σαφές ότι το πολίτευμα της μέσης τάξης είναι άριστο, γιατί είναι το μόνο αστασίαστο πολίτευμα, αφού ελάχιστα φαινόμενα επαναστάσεων κι αντιπαλότητας των πολιτών παρατηρούνται εκεί, όπου η μεσαία τάξη είναι μεγάλη».
 
            Όμως, η συνείδηση της σημασίας της μεσαίας τάξης για τη συγκρότηση της πολιτείας δε συνεπάγεται και την αυτόματη κατοχύρωση της αξίας της ως πηγή ευτυχίας. Κι αυτό είναι ξεκάθαρο θέμα παιδείας. Το γεγονός ότι η ευτυχία συνδυάζεται (σχεδόν) πάντα με το χρήμα είναι η αποτυχία των πολιτών να προσεγγίσουν σωστά την ευτυχία σε ατομικό και κατά συνέπεια σε συλλογικό επίπεδο. Η κοινωνία που θεοποιεί το χρήμα δεν μπορεί παρά να λειτουργήσει συγκρουσιακά μετατρέποντας τους θεσμούς σε πεδίο κατοχύρωσης συμφερόντων. Υπό αυτούς τους όρους η πολιτική εκπροσώπηση, η δικαιοσύνη, η εκπαίδευση, όλοι οι θεμελιώδεις κοινωνικοί θεσμοί τίθενται στη λογική της ιδιοτέλειας, δηλαδή της επιβολής. Μοιραία, παίρνουν το δρόμο της χειραγώγησης. Το μόνο που μένει είναι η κοινωνική αδικία ως ατράνταχτη απόδειξη της πολιτικής στρέβλωσης.
 
            Η άποψη του Αριστοτέλη ότι ο πολιτικός πρέπει να ανήκει στη μεσαία τάξη, ώστε να διασφαλίζεται η ακεραιότητά του, κρίνεται μάλλον επίφοβη: «είναι μεγάλο ευτύχημα όσοι δραστηριοποιούνται πολιτικά, να έχουν μέσου μεγέθους περιουσία, γιατί, όπου άλλοι έχουν υπερβολικά πολλά και άλλοι τίποτε, εκεί εμφανίζεται ή το τελευταίο είδος της δημοκρατίας ή άκρατη ολιγαρχία ή τυραννίδα εξαιτίας των δύο αυτών ακροτήτων». Και είναι επίφοβη γιατί η μεσαία τάξη δεν αποτελεί επιλογή. Ο μεσαίος, αν βρει επαγγελματική ευκαιρία, μπορεί να δουλεύει ακατάπαυστα για την ελπίδα του πλουτισμού. Σε πολλές περιπτώσεις δε διστάζει να χρησιμοποιήσει αθέμιτα κι επικίνδυνα μέσα και είναι πρόθυμος να συγκρουστεί με άλλους μεσαίους προκειμένου να αυξήσει το εισόδημά του. Συνήθως προσπαθεί να μιμηθεί τις συνήθειες των ανθρώπων που τον ξεπερνούν οικονομικά. Η έννοια μικροαστός, που απευθύνεται κυρίως στα χαμηλά στρώματα των μεσαίων – δεν είναι όλοι οι μεσαίοι το ίδιο, όπως δεν είναι και όλοι οι πλούσιοι το ίδιο – λειτουργεί πρωτίστως υποτιμητικά.
 
            Ο μεσαίος που αρκείται σ’ αυτά που έχει και απολαμβάνει τη ζωή με τα μέσα που έχει χωρίς να μπαίνει στο παιχνίδι της περαιτέρω απόκτησης είναι ο φιλοσοφημένος άνθρωπος. Είναι αυτός που γνωρίζει την αξία του μέτρου. Όμως σε καμία περίπτωση δε θα μπορούσαμε να πούμε ότι αυτό αποτελεί επικρατούσα κοινωνική αντίληψη. Η μεσότητα στον πλούτο, με τον τρόπο που τη θέτει ο Αριστοτέλης, δεν έχει αποκτήσει ιδεολογικό ανάστημα κι αν εννοήσουμε ως μέτρο το μέγεθος των πραγματικών αναγκών θα λέγαμε ότι τα όρια έχουν χαθεί εντελώς. Ο άνθρωπος πρέπει να συνειδητοποιήσει ότι η ευτυχία και η καταξίωση δεν αφορούν τον άμετρο πλούτο – κι αυτός είναι ο λόγος που η μεσαία τάξη πρέπει να θεωρείται επιθυμητή. Η επιμονή του ανθρώπου στην αναζήτηση του πλούτου είναι η απομάκρυνση από τις χαρές της ζωής, που σε τελική ανάλυση είναι καταδικασμένες στην απλότητα: «Ακόμη οι πολίτες της μέσης τάξης έχουν τη μεγαλύτερη ασφάλεια στις πόλεις, γιατί ούτε επιθυμούν τα ξένα αγαθά, όπως οι φτωχοί, ούτε άλλοι τα δικά τους, όπως οι φτωχοί ζηλεύουν τα αγαθά των πλουσίων. Έτσι ζουν χωρίς κινδύνους, γιατί ούτε υπονομεύονται ούτε υπονομεύουν. Από αυτά δικαιώνεται η ευχή του Φωκυλίδη: “Οι μέσοι έχουν πολλά άριστα πράγματα. Θέλω να ανήκω στους μέσους”».
 
Αριστοτέλης: Πολιτικά